EnglishFrenchSpanish

OnWorks favicon

tqs - Online in the Cloud

Run tqs in OnWorks free hosting provider over Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

This is the command tqs that can be run in the OnWorks free hosting provider using one of our multiple free online workstations such as Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

PROGRAM:

NAME


tqs - Trim Quality Solexa-Illumina Sequences

SYNOPSIS


Quality trim solexa-Illumina sequence reads using user-defined thresholds.

OPTIONS


-h, --help
show this help message and exit

-f SEQFILE, --sequence file=SEQFILE
Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt):
7 1 255 669
AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC

-q QUALFILE, --qual file=QUALFILE
A prb file containing all the Illumina intensities, as outputted by the 1G
Genome Analyzer (_prb.txt)

-l MER, --length=MER
Length of sequence reads (i.e. Number of sequencing cycles, default=36)

-t THRESHOLD, --threshold=THRESHOLD
Base intensity threshold value (-40 to 40, default=5)

-d DIFF, --difference=DIFF
Base intensity difference between top intensity and second best (1 to 80,
default=5)

-c CONSEC, --consec=CONSEC
Minimum number of consecutive bases passing threshold values (default=20)

-v, --verbose
Runs in Verbose mode.

Use tqs online using onworks.net services


Free Servers & Workstations

Download Windows & Linux apps

  • 1
    PostInstallerF
    PostInstallerF
    PostInstallerF will install all the
    software that Fedora Linux and others
    doesn't include by default, after
    running Fedora for the first time. Its
    easy for...
    Download PostInstallerF
  • 2
    strace
    strace
    The strace project has been moved to
    https://strace.io. strace is a
    diagnostic, debugging and instructional
    userspace tracer for Linux. It is used
    to monitor a...
    Download strace
  • 3
    gMKVExtractGUI
    gMKVExtractGUI
    A GUI for mkvextract utility (part of
    MKVToolNix) which incorporates most (if
    not all) functionality of mkvextract and
    mkvinfo utilities. Written in C#NET 4.0,...
    Download gMKVExtractGUI
  • 4
    JasperReports Library
    JasperReports Library
    JasperReports Library is the
    world's most popular open source
    business intelligence and reporting
    engine. It is entirely written in Java
    and it is able to ...
    Download JasperReports Library
  • 5
    Frappe Books
    Frappe Books
    Frappe Books is a free and open source
    desktop book-keeping software that's
    simple and well-designed to be used by
    small businesses and freelancers. It'...
    Download Frappe Books
  • 6
    Numerical Python
    Numerical Python
    NEWS: NumPy 1.11.2 is the last release
    that will be made on sourceforge. Wheels
    for Windows, Mac, and Linux as well as
    archived source distributions can be fou...
    Download Numerical Python
  • More »

Linux commands

Ad