EnglishFrenchSpanish

OnWorks favicon

tqs - Online in the Cloud

Run tqs in OnWorks free hosting provider over Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

This is the command tqs that can be run in the OnWorks free hosting provider using one of our multiple free online workstations such as Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

PROGRAM:

NAME


tqs - Trim Quality Solexa-Illumina Sequences

SYNOPSIS


Quality trim solexa-Illumina sequence reads using user-defined thresholds.

OPTIONS


-h, --help
show this help message and exit

-f SEQFILE, --sequence file=SEQFILE
Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt):
7 1 255 669
AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC

-q QUALFILE, --qual file=QUALFILE
A prb file containing all the Illumina intensities, as outputted by the 1G
Genome Analyzer (_prb.txt)

-l MER, --length=MER
Length of sequence reads (i.e. Number of sequencing cycles, default=36)

-t THRESHOLD, --threshold=THRESHOLD
Base intensity threshold value (-40 to 40, default=5)

-d DIFF, --difference=DIFF
Base intensity difference between top intensity and second best (1 to 80,
default=5)

-c CONSEC, --consec=CONSEC
Minimum number of consecutive bases passing threshold values (default=20)

-v, --verbose
Runs in Verbose mode.

Use tqs online using onworks.net services


Free Servers & Workstations

Download Windows & Linux apps

  • 1
    Image Downloader
    Image Downloader
    Crawl and download images using
    Selenium Using python3 and PyQt5.
    Supported Search Engine: Google, Bing,
    Baidu. Keywords input from the keyboard
    or input from ...
    Download Image Downloader
  • 2
    Eclipse Tomcat Plugin
    Eclipse Tomcat Plugin
    The Eclipse Tomcat Plugin provides
    simple integration of a tomcat servlet
    container for the development of java
    web applications. You can join us for
    discussio...
    Download Eclipse Tomcat Plugin
  • 3
    WebTorrent Desktop
    WebTorrent Desktop
    WebTorrent Desktop is for streaming
    torrents on Mac, Windows or Linux. It
    connects to both BitTorrent and
    WebTorrent peers. Now there's no
    need to wait for...
    Download WebTorrent Desktop
  • 4
    GenX
    GenX
    GenX is a scientific program to refine
    x-ray refelcetivity, neutron
    reflectivity and surface x-ray
    diffraction data using the differential
    evolution algorithm....
    Download GenX
  • 5
    pspp4windows
    pspp4windows
    PSPP is a program for statistical
    analysis of sampled data. It is a free
    replacement for the proprietary program
    SPSS. PSPP has both text-based and
    graphical us...
    Download pspp4windows
  • 6
    Git Extensions
    Git Extensions
    Git Extensions is a standalone UI tool
    for managing Git repositories. It also
    integrates with Windows Explorer and
    Microsoft Visual Studio
    (2015/2017/2019). Th...
    Download Git Extensions
  • More »

Linux commands

Ad