Amazon Best VPN GoSearch

OnWorks favicon

gt-fingerprint - Online in the Cloud

Run gt-fingerprint in OnWorks free hosting provider over Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

This is the command gt-fingerprint that can be run in the OnWorks free hosting provider using one of our multiple free online workstations such as Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

PROGRAM:

NAME


gt-fingerprint - Compute MD5 fingerprints for each sequence given in a set of sequence
files.

SYNOPSIS


gt fingerprint [option ...] sequence_file [...]

DESCRIPTION


-check [filename]
compare all fingerprints contained in the given checklist file with checksums in given
sequence_files(s). The comparison is successful, if all fingerprints given in
checkfile can be found in the sequence_file(s) in the exact same quantity and vice
versa. (default: undefined)

-duplicates [yes|no]
show duplicate fingerprints from given sequence_file(s). (default: no)

-extract [string]
extract the sequence(s) with the given fingerprint from sequence file(s) and show them
on stdout. (default: undefined)

-width [value]
set output width for FASTA sequence printing (0 disables formatting) (default: 0)

-o [filename]
redirect output to specified file (default: undefined)

-gzip [yes|no]
write gzip compressed output file (default: no)

-bzip2 [yes|no]
write bzip2 compressed output file (default: no)

-force [yes|no]
force writing to output file (default: no)

-help
display help and exit

-version
display version information and exit

If neither option -check nor option -duplicates is used, the fingerprints for all
sequences are shown on stdout.

Fingerprint of a sequence is case insensitive. Thus MD5 fingerprint of two identical
sequences will be the same even if one is soft-masked.

EXAMPLES


Compute (unified) list of fingerprints:

$ gt fingerprint U89959_ests.fas | sort | uniq > U89959_ests.checklist_uniq

Compare fingerprints:

$ gt fingerprint -check U89959_ests.checklist_uniq U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 only in sequence_file(s)

Make sure a sequence file contains no duplicates (not the case here):

$ gt fingerprint -duplicates U89959_ests.fas
950b7715ab6cc030a8c810a0dba2dd33 2
gt fingerprint: error: duplicates found: 1 out of 200 (0.500%)

Extract sequence with given fingerprint:

$ gt fingerprint -extract 6d3b4b9db4531cda588528f2c69c0a57 U89959_ests.fas
>SQ;8720010
TTTTTTTTTTTTTTTTTCCTGACAAAACCCCAAGACTCAATTTAATCAATCCTCAAATTTACATGATAC
CAACGTAATGGGAGCTTAAAAATA

RETURN VALUES


· 0 everything went fine (-check: the comparison was successful; -duplicates: no
duplicates found)

· 1 an error occurred (-check: the comparison was not successful; -duplicates:
duplicates found)

REPORTING BUGS


Report bugs to <[email protected]>.

Use gt-fingerprint online using onworks.net services


Free Servers & Workstations

Download Windows & Linux apps

Linux commands

Ad




×
Advertisement
❤️Shop, book, or buy here — no cost, helps keep services free.