EnglishFrenchSpanish

OnWorks favicon

tqs - Online in the Cloud

Run tqs in OnWorks free hosting provider over Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

This is the command tqs that can be run in the OnWorks free hosting provider using one of our multiple free online workstations such as Ubuntu Online, Fedora Online, Windows online emulator or MAC OS online emulator

PROGRAM:

NAME


tqs - Trim Quality Solexa-Illumina Sequences

SYNOPSIS


Quality trim solexa-Illumina sequence reads using user-defined thresholds.

OPTIONS


-h, --help
show this help message and exit

-f SEQFILE, --sequence file=SEQFILE
Illumina sequence file - Output format from the 1G Genome Analyzer (_seq.txt):
7 1 255 669
AACCCCCACTCCTACAACGCCATCATTCCCCTCGAC

-q QUALFILE, --qual file=QUALFILE
A prb file containing all the Illumina intensities, as outputted by the 1G
Genome Analyzer (_prb.txt)

-l MER, --length=MER
Length of sequence reads (i.e. Number of sequencing cycles, default=36)

-t THRESHOLD, --threshold=THRESHOLD
Base intensity threshold value (-40 to 40, default=5)

-d DIFF, --difference=DIFF
Base intensity difference between top intensity and second best (1 to 80,
default=5)

-c CONSEC, --consec=CONSEC
Minimum number of consecutive bases passing threshold values (default=20)

-v, --verbose
Runs in Verbose mode.

Use tqs online using onworks.net services


Free Servers & Workstations

Download Windows & Linux apps

  • 1
    Osu!
    Osu!
    Osu! is a simple rhythm game with a well
    thought out learning curve for players
    of all skill levels. One of the great
    aspects of Osu! is that it is
    community-dr...
    Download Osu!
  • 2
    LIBPNG: PNG reference library
    LIBPNG: PNG reference library
    Reference library for supporting the
    Portable Network Graphics (PNG) format.
    Audience: Developers. Programming
    Language: C. This is an application that
    can also...
    Download LIBPNG: PNG reference library
  • 3
    Metal detector based on  RP2040
    Metal detector based on RP2040
    Based on Raspberry Pi Pico board, this
    metal detector is included in pulse
    induction metal detectors category, with
    well known advantages and disadvantages.
    RP...
    Download Metal detector based on RP2040
  • 4
    PAC Manager
    PAC Manager
    PAC is a Perl/GTK replacement for
    SecureCRT/Putty/etc (linux
    ssh/telnet/... gui)... It provides a GUI
    to configure connections: users,
    passwords, EXPECT regula...
    Download PAC Manager
  • 5
    GeoServer
    GeoServer
    GeoServer is an open-source software
    server written in Java that allows users
    to share and edit geospatial data.
    Designed for interoperability, it
    publishes da...
    Download GeoServer
  • 6
    Firefly III
    Firefly III
    A free and open-source personal finance
    manager. Firefly III features a
    double-entry bookkeeping system. You can
    quickly enter and organize your
    transactions i...
    Download Firefly III
  • More »

Linux commands

Ad